Write the tRNA sequence for the given strand of mRNA 7. AGGUCAUGCAUGGGCAUGCAU 8.AGAGAUUCAGCUAGCACGAUA I​

answer; i believe its echoic memory,it is believed to last three to four seconds; good luck

question: which statement best describes the different properties of metals?

answer: they are shiny and bend without breaking.

since metals have certain characteristics properties, they include the following: they are ductile, malleable, shiny, hard, lustrous, flexible and they are good conductor of heat and electricity. so therefore, metals are not dull and they are not non-flexible as listed. instead, they are shiny and flexible.

hope this , have a good day. c;