Biology
Biology, 15.05.2021 06:30, violetagamez2

Approximately 75% of all breast cancers grow in response to the hormone estrogen. An additional 65% of cancers also
grow in response to the hormone progesterone. A targeted
therapy that prevents activation of estrogen and progesterone
receptors in breast cancer would be beneficial to which type
of patient?

answer
Answers: 1

Other questions on the subject: Biology

image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 12:00, whocares1234
Label the steps for protein synthesis in order, beginning with the first steponce the protein is made, the gene for a particular trait is expressedmrna joins the ribosome, and the anticodons from trna join mrna to form a chain ofamino acidsrna polymerase unzips dna and free rna nucleotides join dna to form mrnav a chain of amino acids is formed from peptide bonds, creating a proteinmrna is transported from the nucleus of the cell to the ribosomes of the cell.
Answers: 1
image
Biology, 22.06.2019 13:00, shanicet047ox9ff6
This rapid change in species that rarely leaves behind fossil evidence is referred to as
Answers: 3
image
Biology, 22.06.2019 17:00, emwemily
Which of the following describes what an activator an enhancer are
Answers: 2
Do you know the correct answer?
Approximately 75% of all breast cancers grow in response to the hormone estrogen. An additional 65%...

Questions in other subjects:

Konu
Mathematics, 18.09.2019 08:10
Konu
Mathematics, 18.09.2019 08:10
Konu
Mathematics, 18.09.2019 08:10