Two radioactive nuclei A and B are present in equal numbers to begin with. Three days later, there are 2.44 times as many A nuclei as there are B nuclei. The half-life of species B is 1.14 days. Find the half-life of species A (in days).

In tossing one coin 10 times, what are your chances for tossing a head? a tail? 2. in tossing one coin 100 times, what are your chances for tossing a head? a tail? 3. in tossing one coin 200 times, what are your chances for tossing a head? a tail? deviation = ((absolute value of the difference between expected heads and observed heads) + (absolute value of the difference between expected tails and observed tails)) divided by total number of tosses. this value should always be positive. 4. what is the deviation for 10 tosses? 5. what is the deviation for the 100 tosses? 6. what is the deviation for 200 tosses? 7. how does increasing the total number of coin tosses from 10 to 100 affect the deviation? 8. how does increasing the total number of tosses from 100 to 200 affect the deviation? 9. what two important probability principles were established in this exercise? 10. the percent of occurrence is the obtained results divided by the total tosses and multiplied by 100%. toss the coins 100 times and record your results. calculate the percent occurrence for each combination. percent head-head occurrence: percent tail-tail occurrence: percent head-tail occurrence:

Where can dna be found in a prokaryotic cell

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?