Biology, 01.05.2021 17:00, coltonduggan
Which most likely happens to the ovary of a flower after it is fertilized?
a. It produces pollen.
b. It grows into a fruit or vegetable.
c. It grows new sepals to attract insects.
d. It completes photosynthesis.
Answers: 3
Biology, 21.06.2019 21:50, mqturner1989Kedie
Which element is found in both dna and proteins
Answers: 2
Biology, 22.06.2019 04:30, jillericamurph46
The nursing instructor has been observing nursing students initiate an iv infusion. which action(s), if made by the nursing student, indicates that further instruction is needed? (select all that apply.) the nursing student:
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Which most likely happens to the ovary of a flower after it is fertilized?
a. It produces pollen.<...
Mathematics, 29.10.2020 01:00
Arts, 29.10.2020 01:00
Spanish, 29.10.2020 01:00