2 points Which of the following are similar about eukaryotic DNA replication and
prokaryotic DNA replication. Check all that apply.
It only occurs are one site along the DNA
there is a leading strand and a lagging strand
DNA helicase, ligase, and polymerase all work together to create new DNA
The DNA is arranged in a circle.

As , plants meet their needs for making food from air, soil, water, and the sun's energy in a process called there are plants called grow high in trees without here are words to put in the blanks. 1.) producers 2.) consumers 3.) chloroplasts 4.) epiphytes

What noticeable trend from this graph might be used to make a conclusion?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?