Biology, 26.04.2021 07:50, vanessa674
Regulation of genes is extremely important for conserving energy, differentiation of tissues, and proper expression of traits. In order for transcription of a gene to take place, eukaryotic cells need RNA polymerase and which of the following molecules
Answers: 3
Biology, 22.06.2019 01:00, gabrielaperezcz
Dermal tissue in plants stores 1.extra food 2.transports water and nutrients 3.transports waste materials 4.is similar to epithelial cells in animals
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 16:10, Lovebamagirl12
While washing her hair olivia noticed that she was losing a lot of hair she visited a clinic and the physician reassured her that her hair would grow back how do you think olivias hair will grow back
Answers: 1
Regulation of genes is extremely important for conserving energy, differentiation of tissues, and pr...
Geography, 04.04.2020 05:00
English, 04.04.2020 05:00