Which statement best describes an understanding of genetics that would be missing without the work of mendel?
a. the dna codes for traits would not be known.
b. the protein codes for traits would not be known.
c. some alleles are dominant, and some alleles are recessive.
d. offspring receive two copies of each allele from each parent.

The image below shows a common blood pressure gauge. what does this device do? a. measures the level of oxygen present in the blood b. measures the pressure of blood when the lungs expand and compress c. measures the electrical activity of the heart d. measures the pressure of blood when the heart contracts and relaxes

Suppose you use three different scale to weigh a bag of organges. one scale says the nag weighs 2.1 lb, and third says it weighs 2.1 lb. the actual weight of the bag of organges is 2.153 lb. which of the following best decribes these results?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?