What is likely to happen to the ecosystem pictured below after a period of time?

picture is volcanic activity

a. the ecosystem will undergo only primary succession. b. the ecosystem will undergo only secondary succession. c. the ecosystem will undergo primary succession followed by secondary succession. d. the ecosystem will never recover.

Food webs - transferring energy and matter from one level to another. here you see four food webs. one or more are incorrect. which food web(s) show the correct sequence of organisms, from start to top level consumer? a) a b) d c) c d) a and d

Number and variety of living organism; includes genetic, species, and ecological types

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?