Abyssinian guinea pigs have a rosette (long and bushy) coat that is controlled by a dominant gene. a short and smooth coat is recessive to the rosette allele. a breeder conducts a testcross to see if his abyssinian guinea pig is homozygous or heterozygous. if the pig is homozygous, what is the phenotypic ratio in the offspring?
Answers: 3
Biology, 21.06.2019 16:30, shayla3613
Wht happens as electrons in the electron transport chain release their energy
Answers: 3
Biology, 22.06.2019 06:50, Shaylaharrison15
The kidney filters potentially toxic substances in the blood, and thus “clears” the blood of those substances. this clearance function is dependent upon and proportional to the diffusion gradient of the substance across filtering capillaries, i. e. if the concentration of the substance is doubled, twice as much will be cleared from each ml of blood that is filtered. suppose that the body produces a constant amount of a substance x per unit of time. the kidneys eliminate substance x at a rate directly proportional to the concentration of the substance and the volume of blood cleared each minute (c): elimination = c × [x], where [x] is the steady-state concentration of substance x. imagine an individual with an initial concentration of x equal to [x]0 who develops kidney disease. her baseline clearance c0 drops to one half of the original (½c0). what is the new steady state concentration of x? (for simplicity, assume that substance x is 100% filtered by the kidney).
Answers: 1
Biology, 22.06.2019 10:30, jagslovegirl
Natural selection changes allele frequencies because some survive and reproduce more successfully than others.
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Abyssinian guinea pigs have a rosette (long and bushy) coat that is controlled by a dominant gene. a...