Biology
Biology, 02.09.2019 05:20, miguelmike2895

Which of these energy resources is the most convenient to use (regardless of location)? a. wind b. solar c. natural gas d. hydroelectric

answer
Answers: 2

Other questions on the subject: Biology

image
Biology, 22.06.2019 07:30, china2221
The ancestors of plants that lived in water had plenty of water for the young. angiosperms are a group of land plants that evolved a reproductive trait for living on land. this trait protect young plants by allowing them to grow only when water is present and the conditions for healthy development are right. what trait most likely young angiosperms in this way?
Answers: 1
image
Biology, 22.06.2019 10:00, tuetheturtle
The double bond between a carbon atom and two oxygen atoms (a molecule of carbon dioxide) has two characteristics. what are they? a. an ionic bond is formed between the oxygen and carbon atoms. b. four valence electrons are shared. c. two valence electrons are shared. d. valence electrons are shared between oxygen atoms.
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 12:00, whocares1234
Label the steps for protein synthesis in order, beginning with the first steponce the protein is made, the gene for a particular trait is expressedmrna joins the ribosome, and the anticodons from trna join mrna to form a chain ofamino acidsrna polymerase unzips dna and free rna nucleotides join dna to form mrnav a chain of amino acids is formed from peptide bonds, creating a proteinmrna is transported from the nucleus of the cell to the ribosomes of the cell.
Answers: 1
Do you know the correct answer?
Which of these energy resources is the most convenient to use (regardless of location)? a. wind b....

Questions in other subjects: