![Biology](/tpl/images/cats/biologiya.png)
Biology, 27.10.2019 07:43, zakyiaiarvis544
Which polymers carry the information for cell growth and reproduction from one generation to the next a)proteins b) starches c) lipids d) nucleic acids
![answer](/tpl/images/cats/otvet.png)
Answers: 2
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 02:30, brenyasanders5345
Many plants can reproduce asexually. which of these is an example of asexual reproduction in a plant? a. pine cones forming on a tree b. cross-pollination in a tomato c. roots sprouting from a potato d. night-blooming jasmine flowers
Answers: 3
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 04:20, leothedrifter
Do you think the gene eef1 alpha1 supports cell theory? explain your response.
Answers: 2
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 11:00, greciakawaii
2. which of the following statements does not accurately describe stem cells? a. embryonic stem cells make up the inner cell mass of a blastocyst. b. with more research, stem cells may be used to repair or replace damaged cells. c. the use of stem cells is without any objections since it can be used in therapies to humans. d. adult stem cells are multipotent and can differentiate into many types of cells.
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
Which polymers carry the information for cell growth and reproduction from one generation to the nex...
Questions in other subjects:
![Konu](/tpl/images/cats/mat.png)
Mathematics, 09.11.2020 17:50
![Konu](/tpl/images/cats/es.png)
Spanish, 09.11.2020 17:50
![Konu](/tpl/images/cats/ekonomika.png)
Business, 09.11.2020 17:50
![Konu](/tpl/images/cats/mat.png)
Mathematics, 09.11.2020 17:50
![Konu](/tpl/images/cats/mat.png)
Mathematics, 09.11.2020 17:50
![Konu](/tpl/images/cats/himiya.png)
Chemistry, 09.11.2020 17:50
![Konu](/tpl/images/cats/es.png)
![Konu](/tpl/images/cats/ekonomika.png)
![Konu](/tpl/images/cats/en.png)
English, 09.11.2020 17:50