Biology
Biology, 03.02.2020 20:53, lilagvaldez15

Which structures that distinguish a eukaryotic cell from a prokaryotic cell are part of the internal membrane system?

chromatin, mitochondrion, nucleus, plasma membrane

nuclear membrane, endoplasmic reticulum, golgi apparatus, and vesicle

golgi apparatus, chromatin, vesicle, plasma membrane

nucleus, nuclear membrane, mitochondrion, endoplasmic reticulum

answer
Answers: 2

Other questions on the subject: Biology

image
Biology, 22.06.2019 04:30, jesse7412
The picture showed normal blood cells which are around and sickle cells which appear much longer people with sickle-cell suffer from the sickle cell anemia which is inherited diseaseit is caused by a change in gene responsible for production of hemo goblin this type of change is known as an
Answers: 2
image
Biology, 22.06.2019 08:20, dez2745
2. which is the last step in the scientific method?
Answers: 2
image
Biology, 22.06.2019 10:00, oscarmasinde44
Which substance contains thylakoids? a) nadph b)atp c)stroma d)chloroplast
Answers: 2
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
Which structures that distinguish a eukaryotic cell from a prokaryotic cell are part of the internal...

Questions in other subjects:

Konu
Mathematics, 30.10.2020 18:10