Biology, 19.04.2021 02:20, dakmil79

1) If a messenger RNA has the sequence: 5’ AUGGCAUACGCAUUAUUGUCUGAGGAAUAAGAG 3'
a) What is the corresponding sequence of the coding strand (DNA)?
b) What is the corresponding sequence of the template strand (DNA)?
c) What is each anticodon and what amino acid do the corresponding tRNA's carry?
d) What amino acid sequence would be translated from this mRNA fragment?

1) If a messenger RNA has the sequence:

5’ AUGGCAUACGCAUUAUUGUCUGAGGAAUAAGAG 3'
a) What is the co

Answers: 3

Show answers

Other questions on the subject: Biology

Biology, 22.06.2019 00:40, cselder

There is a liquid capsule inside a cup full of liquid. the cup full of liquid has salt in it and the liquid capsule has no salt in it. in which direction will the solvent flow? a. the salt does not have to move b. from the capsule to the larger cup c. equally between the capsule and the cup d. from the larger cup to the capsule

Answers: 1

continue

Biology, 22.06.2019 12:30, ryanmorse01

When rutherford performed his metal foil experiment, he was surprised that most of the alpha particles

Answers: 1

continue

Biology, 23.06.2019 00:10, GamerGirl15

If this person had son, what, sex chromosome did they give their son? a. x b. y c. neither d. we need more information to know for sure

Answers: 1

continue

Biology, 23.06.2019 00:30, theuniicorntamer

Imagine that you are a doctor in a maternity ward. during your last shift, 20 babies were born. 10 had blue eyes, and 10 had brown eyes. 15 had round heads, and 5 had pointed heads. what are the parents phenotypes/traits?

Answers: 2

continue

Do you know the correct answer?

1) If a messenger RNA has the sequence: 5’ AUGGCAUACGCAUUAUUGUCUGAGGAAUAAGAG 3'
a) What is th...