1) If a messenger RNA has the sequence:
5β AUGGCAUACGCAUUAUUGUCUGAGGAAUAAGAG 3'
a) What is th...
1) If a messenger RNA has the sequence:
5β AUGGCAUACGCAUUAUUGUCUGAGGAAUAAGAG 3'
a) What is the corresponding sequence of the coding strand (DNA)?
b) What is the corresponding sequence of the template strand (DNA)?
c) What is each anticodon and what amino acid do the corresponding tRNA's carry?
d) What amino acid sequence would be translated from this mRNA fragment?
Answers: 3
Biology, 22.06.2019 00:40, cselder
There is a liquid capsule inside a cup full of liquid. the cup full of liquid has salt in it and the liquid capsule has no salt in it. in which direction will the solvent flow? a. the salt does not have to move b. from the capsule to the larger cup c. equally between the capsule and the cup d. from the larger cup to the capsule
Answers: 1
Biology, 22.06.2019 12:30, ryanmorse01
When rutherford performed his metal foil experiment, he was surprised that most of the alpha particles
Answers: 1
Biology, 23.06.2019 00:10, GamerGirl15
If this person had son, what, sex chromosome did they give their son? a. x b. y c. neither d. we need more information to know for sure
Answers: 1
Biology, 23.06.2019 00:30, theuniicorntamer
Imagine that you are a doctor in a maternity ward. during your last shift, 20 babies were born. 10 had blue eyes, and 10 had brown eyes. 15 had round heads, and 5 had pointed heads. what are the parents phenotypes/traits?
Answers: 2
Advanced Placement (AP), 03.08.2019 02:40
History, 03.08.2019 02:40
Mathematics, 03.08.2019 02:40
English, 03.08.2019 02:40
Mathematics, 03.08.2019 02:40
History, 03.08.2019 02:40