Biology, 10.01.2020 19:31, ondreduty1789
Acertain segment of dna can be used as a molecular clock. its rate of mutation is one mutation per 20 million years. examine the dna segments from two different species:
species a: gtacctaagttcaccgaatt
species b: gaacctaagggcaccgaact
using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor.
Answers: 2
Biology, 21.06.2019 13:00, angel234wilcox
Biologists use the system of binomial nomenclature developed by linnaeus to assign scientific names to known living organisms which area of society or strengthened by money is contribution to science
Answers: 3
Biology, 21.06.2019 22:00, cupcake3103670
Actual age your first developed of age well comparison age refers to absolute age true or false
Answers: 1
Biology, 22.06.2019 02:30, melissaschnelting
Below, the levels of organization in a multicellular organism are shown from least to most complex. which level of organization can be described as several different types of tissues working together to perform a common task?
Answers: 1
Biology, 22.06.2019 03:40, lashaunahard
20. in humans, freckles are dominant to no freckles. trey has no freckles and his wife anna grace has freckles, but her dad doesn't. they want to know what percentage of their kids would look like trey. show a punnett square to support your answer.
Answers: 1
Acertain segment of dna can be used as a molecular clock. its rate of mutation is one mutation per 2...
Law, 15.01.2021 14:50
Mathematics, 15.01.2021 14:50
Chemistry, 15.01.2021 14:50
Mathematics, 15.01.2021 14:50