Biology, 15.04.2021 20:30, austinkellylay
Which of the following is not a reason why regrowth is usually faster in secondary succession?
a. Stumps and roots and some plants can re-grow
b. Secondary shrubs create the soil making process
c. The area still has a soil base
d. Seeds can be found in the soil
Answers: 3
Biology, 22.06.2019 06:50, jerrica988
Drag the tiles to the correct boxes to complete the pairs. match the nitrogenous base of dna with its complement.
Answers: 3
Biology, 22.06.2019 11:30, heavendl13
Which of the following does not make up ground substance of connective tissue? hyaluronic acid elastic fibers glycosaminoglycan proteoglycan
Answers: 3
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Which of the following is not a reason why regrowth is usually faster in secondary succession?
a. S...
History, 22.01.2021 17:50
Mathematics, 22.01.2021 17:50
Mathematics, 22.01.2021 17:50
Mathematics, 22.01.2021 17:50
History, 22.01.2021 17:50
Mathematics, 22.01.2021 17:50
Mathematics, 22.01.2021 17:50