Answers: 1
Biology, 21.06.2019 15:30, lazybridplayer
Rank the three variables in terms of how strongly they affect the "species" composition of the bacterial communities. place the variable with the weakest effect on the left and the variable with the strongest effect on the right.
Answers: 2
Biology, 22.06.2019 02:50, mccay5016987
Keeping in mind the life cycle of bacteriophages, consider the following problem: during the reproductive cycle of a temperate bacteriophage, the viral dna inserts into the bacterial chromosome where the resultant prophage behaves much like a trojan horse. it can remain quiescent, or it can become lytic and initiate a burst of progeny viruses. several operons maintain the prophage state by interacting with a repressor that keeps the lytic cycle in check. insults (ultraviolet light, for example) to the bacterial cell lead to a partial breakdown of the repressor, which in turn causes the production of enzymes involved in the lytic cycle. as stated in this simple form, would you consider this system of regulation to be operating under positive or negative control?
Answers: 1
Biology, 22.06.2019 03:50, FoxGirl1971
2. how does the miller-urey experiment fall short of demonstrating that life can arise from inorganic molecules? explain. a. it doesn't show a leap between a collection of amino acids and a single-celled organism. b. it recreates the conditions that existed at the earth's beginning, but no molecules form as a result. c. it doesn't provide evidence of the formation of amino acids. d. it doesn't show how multicellular organisms developed from unicellular organisms
Answers: 2
What is the mRNA in TACCGGATGCCAGATCAAATC?...
Arts, 02.02.2020 16:44
Social Studies, 02.02.2020 16:44
Mathematics, 02.02.2020 16:44
History, 02.02.2020 16:44
Mathematics, 02.02.2020 16:44
Arts, 02.02.2020 16:44