What is the mRNA in TACCGGATGCCAGATCAAATC?

Rank the three variables in terms of how strongly they affect the "species" composition of the bacterial communities. place the variable with the weakest effect on the left and the variable with the strongest effect on the right.

List two limitations of natural selection

Keeping in mind the life cycle of bacteriophages, consider the following problem: during the reproductive cycle of a temperate bacteriophage, the viral dna inserts into the bacterial chromosome where the resultant prophage behaves much like a trojan horse. it can remain quiescent, or it can become lytic and initiate a burst of progeny viruses. several operons maintain the prophage state by interacting with a repressor that keeps the lytic cycle in check. insults (ultraviolet light, for example) to the bacterial cell lead to a partial breakdown of the repressor, which in turn causes the production of enzymes involved in the lytic cycle. as stated in this simple form, would you consider this system of regulation to be operating under positive or negative control?