Biology, 12.04.2021 22:00, laceybabin1952
Suppose you are studying a mutant strain of mice, called wimpy, that displays excessive submissive behavior. After extensive genetic crosses and mapping, you now think that you have zeroed in on the gene to which the wimpy mutation probably maps. To expedite your investigations you' re going to have to make some educated guesses about the structure and cell biology of the protein. Due to homology with other genes you tentatively assume that this protein is a cell surface receptor and that segment 1 is a cleaved ER signal signal sequence.
Required:
Draw the most likely topology of the protein in the plasma membrane.
Answers: 3
Biology, 22.06.2019 01:30, nadiareese
Select the correct answer. which term do biologists use to describe the average number of individuals of a species per unit area? a. carrying capacity b. population density c. minimal viable population d. survivability curve
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 18:30, maleja2038
12) several teeth were found in an area of flat land covered with trees and plants. the teeth were examined by a paleontologist, and it was determined that the teeth came from a shark. they found many other shark teeth in this area. however, the people who discovered the teeth were puzzled, because there was no source of water near where the fossils were found. what is the paleontologist's best explanation for why the teeth were found in this area? a) sharks used to live on flat land. b) this area was once covered with salt water. c) this area was once covered with freshwater. d) someone buried the shark teeth deep in the ground.
Answers: 1
Biology, 22.06.2019 20:30, teresaparraz34
Explain 3 specific difference or 3 specific similarities between chimpanzee and human behavior
Answers: 2
Suppose you are studying a mutant strain of mice, called wimpy, that displays excessive submissive b...
Mathematics, 14.08.2021 01:20
Mathematics, 14.08.2021 01:20
English, 14.08.2021 01:20
Chemistry, 14.08.2021 01:20
Mathematics, 14.08.2021 01:20
Mathematics, 14.08.2021 01:20