Biology
Biology, 10.04.2021 17:20, tackmancalynn

¿Qué es una unidad formado de colonia? ¿Los microorganismos pueden vivir de forma indefinida en un medio de cultivo?

answer
Answers: 1

Other questions on the subject: Biology

image
Biology, 21.06.2019 20:00, zitterkoph
How do you transfer mrna into codons ? i'm so confused : (
Answers: 2
image
Biology, 22.06.2019 04:00, rileyeddins1010
Indicate the coat color and the proportion of offspring with that color for each of the following crosses of rabbits. assume all are homozygous. chinchilla x chinchilla 1/2 agouti, 1/2 chinchilla 3/4 agouti, 1/4 chinchilla all chinchilla
Answers: 3
image
Biology, 22.06.2019 06:30, Aliyahh5673
Which statement describes a way in which the digestive and excretory systems work together? a. the nephrons absorb nutrients from food going to the large intestine. b. the excretory system balances blood gases in the small intestine. c. the intestinal villi filter blood and send wastes to the bladder. d. the excretory system balances the salts and water obtained from digested food
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
¿Qué es una unidad formado de colonia? ¿Los microorganismos pueden vivir de forma indefinida en un...

Questions in other subjects:

Konu
Mathematics, 01.03.2021 21:50
Konu
Biology, 01.03.2021 21:50
Konu
Mathematics, 01.03.2021 21:50