Biology
Biology, 01.04.2021 18:30, rhucke99121

A student researching bacteria which live in nodules in the roots of certain plans are essential to its survival. Which of the following statements correctly addressed the validity of the claim?​

answer
Answers: 2

Other questions on the subject: Biology

image
Biology, 22.06.2019 07:30, jaylabazemore
What is one way intensive agriculture can contribute to climate change? a. tree loss to agriculture increases earth's albedo b. livestock manure absorbs greenhouse gases c. large herds of livestock release greenhouse gases d. fewer trees are available to replenish petroleum stores appex
Answers: 2
image
Biology, 22.06.2019 10:00, oscarmasinde44
Which substance contains thylakoids? a) nadph b)atp c)stroma d)chloroplast
Answers: 2
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 14:30, kenisonpaigebosma
Asegment id dna that is artificially created from two or more organism through use of dna enzymes in a laboratory is called a segment of dna that is artificially created from two or more organisms through use of dna enzymes in a laboratory is called
Answers: 2
Do you know the correct answer?
A student researching bacteria which live in nodules in the roots of certain plans are essential to...

Questions in other subjects:

Konu
Mathematics, 18.03.2021 02:20
Konu
Mathematics, 18.03.2021 02:20
Konu
Mathematics, 18.03.2021 02:20
Konu
Mathematics, 18.03.2021 02:20