What is the complimentary strand for the DNA AACGGTCCAGTCCAAGTTACG?

Grignard reactions are highly exothermic and are performed in ether solvent. there is a real risk of fire during this reaction. in the case that a fire should occur in your distillation apparatus, what is the best course of action? g

What do all macromolecules have in common with each other? oa. they all are formed from the same elements. ob. they all have major roles in cell membranesoc. they all act as catalysts in the body. od. they all have peptide bonds between carbon atoms.

No plagiarizing ! 6th grade work! easy and 100 compare the parts of a cell and the cell as a whole to another common nonliving system (i. e., a car, a city, describe the parts of a cell and their primary function.