Breaking the Code REPLICATION:
For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results after
replication.
DNA molecule #1:
TACCGGATGCCAGATCAAATC
Complimentary DNA #1:
DNA molecule #2:
TACCGTAACCACAACT
Complementary DNA #2:
DNA molecule #3:
TACCTGTTAAGCTACTT
Complementary DNA #3:

Put the following processes of protein synthesis in the correct order: - dna strands unwind and separate - mrna copies dna according to complimentary base pairing - trna's anticodons bring amino acids to the corresponding mrna codons - amino acids bind to each other making a protein - mrna leaves the nucleus - a stop codon is reached, the newly formed protein is released to go do its job for the cell

Need the diagram below, which is not drawn to scale, shows the position of the earth, moon, and sun. what type of eclipse occurs when the earth, moon, and sun are lined up in the order shown? a. planetary eclipse b. solar eclipse c. martian eclipse d. lunar eclipse

Babies with very low or very high birth weight are less likely to survive. observe a graph of the data.