Answers: 3
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 22:50, jkersen8140
The word belongs in a different group than all of the other words in the list.
Answers: 1
Biology, 23.06.2019 02:10, 2020kaylahernan
Nextend of semester testsubmit testreader toolsinto-samosquitoes in tropical regions can carry and transmit the malaria parasite to humans. the mosquitoes used to be killed in these regions by sprayingthem with the insecticide ddt. the mosquitoes that were earlier sensitive to ddt are now not killed by ddt and grow and multiply even in the presenceof ddt. how can you explain this phenomenon? oa. all of the mosquitoes must have undergone a mutation for ddt resistance and produced similar kind of resistant offspring, whichevolved into a ddt resistant population. b.some of the mosquitoes must have undergone a mutation for ddt resistance and produced similar kind of resistant offspring, whichwould have been selected by nature, oc. all of the mosquitoes must have slowly increased their tolerance level to ddt and ultimately would have become completely resistantto ddtresetnextnext
Answers: 2
Apoptosis does not involve which of the following...
Mathematics, 20.07.2019 15:30
History, 20.07.2019 15:30
Chemistry, 20.07.2019 15:30
Biology, 20.07.2019 15:30