Biology
Biology, 26.03.2021 23:40, cupcake3103670

FOR THE LOVE OF DIRT HELP Genetic testing for the purposes of determining ancestry has increased dramatically over the past five years. This has also increased the DNA databases that hold and control this genetic commodity. Recently, a cold case was solved by genetically linking the suspect to a distant cousin through one of these DNA databases.

A) Explain the social and ethical issues raised by using DNA, donated for the purposes of ancestry information, as evidence to solve crimes.

answer
Answers: 1

Other questions on the subject: Biology

image
Biology, 21.06.2019 21:00, yayaeli
How many cells are our body made of ? β™‘
Answers: 1
image
Biology, 22.06.2019 08:00, ramseynikki87
How water is moving through the ecosystem ?
Answers: 2
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 18:30, smuqtadir124
5points what is term for the process of gathering information through images taken at a distance? o a. global positioning o b. topography o c. remote sensing o d. cartography submit
Answers: 1
Do you know the correct answer?
FOR THE LOVE OF DIRT HELP Genetic testing for the purposes of determining ancestry has increased dr...

Questions in other subjects:

Konu
Social Studies, 10.10.2021 07:00
Konu
Mathematics, 10.10.2021 07:00
Konu
World Languages, 10.10.2021 07:00