Biology

Biology, 26.03.2021 18:30, starfox5454

18 7
1 point
Given the DNA template strand below type the complementary mRNA that would be made during transcription.
13
CCAGTAATGACTTCGATGCA
type your answer...

answer

Answers: 3

Show answers

Other questions on the subject: Biology

Biology, 22.06.2019 03:30, crispingolfer7082

State officials are considering constructing a road through a forested wilderness area. this action will likely affect the forest ecosystem in various ways. part a: predict how the construction of a road could negatively affect plants and animals in that ecosystem. (3 points) part b: describe one way that the construction of a road could have a positive impact of the forest ecosystem. (1 point)

Answers: 1

Biology, 22.06.2019 12:00, ItzAquaZ8716

Matched chromosomes carrying information about the same characteristics in the organism are called

Answers: 1

Biology, 22.06.2019 13:00, micknero

What is the role of dna ligase in the elongation of the lagging strand during dna replication?

Answers: 1

Biology, 22.06.2019 14:50, mihirkantighosh

An organism's reproductive strategy includes all of the following except a. the number of offspring produced. b. the amount of energy expended in producing offspring. c. the length of time parental care is given d. the number of alleles an organism passes on.

Answers: 3

Do you know the correct answer?

18 7
1 point
Given the DNA template strand below type the complementary mRNA that would...

Questions in other subjects:

Konu

Mathematics, 09.04.2020 01:29

How do I do this because I can’t figure it out?...

Konu

Business, 09.04.2020 01:29

A manager has received an analysis of several cities being considered for a new office complex. The data (10 points maximum) are as follows: Location Score Factor A B C Business se...

Konu

Mathematics, 09.04.2020 01:29

Lydia purchased 10 cylinders of water for her pet Fido. Each cylinder 12 inches tall and had a diameter of 18inches. How many cubic inches of water did Lydia purchase ffor Fido...

Konu

Mathematics, 09.04.2020 01:29

Stephen, Gavin and Jim share some sweets in the ratio 2:5:4. Stephen gets 30 sweets. How many did Jim get?...

Konu

English, 09.04.2020 01:29

Stories that include superhuman heroes and fantastical monsters require readers to practice A. the willing suspension of belief. B. critical and analytica...

Konu

English, 09.04.2020 01:29

If attempting to convince a group of young mothers to vote "Yes" on a proposition to make texting and driving illegal, what persuasive technique could be strongest to convince them...

Konu

Biology, 09.04.2020 01:29

Luis by five. 6. on a topographic map, when the contour lines form a "V" pointing uphill, usually with a line representing a creek or river at the center of the "...

Konu

Mathematics, 09.04.2020 01:29

A company makes a set of three boxes that it within one another show separated below Each bas a square base. The base of each smaller box has side length 2 inches shorter tha...

Konu

French, 09.04.2020 01:29

Sur la terrasse du bar, ll y a de longues tables basses...

Konu

Mathematics, 09.04.2020 01:29

Suppose each box of a popular brand of cereal contains a pen as a prize. The pens come in four colors: blue, red, green, and yellow. Each color of pen is equally likely to appear i...

Other tasks in the category: Biology More task