You notice that two mutations result in no expression of the lac operon (Mutations 1 and Mutation 2), two mutations result in low expression of the lac operon even in the presence of lactose and the absence of glucose (Mutation 3 and Mutation 4), and two mutations result in constitutive expression of the lac operon (Mutation 5 and Mutation 6). First, think about what types of mutations could cause the phenotypes you see. Sort each mutation into the bin that describes its expression pattern.

At which location in earth’s interior does the top density continue to increase as thickness decreases?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Grade 91.)the gravitational pull from the moon words).2.) what is the rate of gravitational 3.)if you drop a hammer, is it more likely to drop handle side down, head side down, or equal chance that it will land either way? why? 4.)a car moves 60km east and 90km west. a.) what is the distance the car traveled? b.) what is the car's displacement5.)what is the average velocity of a car that moved 60 km south in 3 hours? 6.) a car starts from rest and acceleration to 60 m/s over a time of 5 seconds. what is the acceleration of the car? 7.)what is the speed of an object at rest?