Fill in the corresponding mrna sequence of the dna strand: atgcgctgcacgtgcacgtt
tacgcgacgtgcacgtgcaa

Sand spinifex grass is adapted to growing on sand dunes. it is a rapidly spreading plant and the creeping runners produce new root systems. which of these best explains the benefits of these features? a. it limits water loss through the leaves. b. it provides support by anchoring the plant. c. it protects the plant from predators. d. it allows the plant to tolerate salt. reset submit

What are the types of mutations, and how does each alter the encoded protein? college level answer

Which type of organism is missing from the food web seen in the illustration? primary consumers decomposers primary producers secondary consumers