Biology, 22.03.2021 22:00, organicmemez

What is the exons and the intron in this dna strand? ATCTCTTGCCAGATAGTGTGA TACAGAACGGTCTATCACACT

Answers: 1

Show answers

Other questions on the subject: Biology

Biology, 21.06.2019 20:00, live4dramaoy0yf9

Why do carbohydrate molecules function so well as fuel for the body?

Answers: 1

continue

Biology, 21.06.2019 22:00, RSanyuathey711

Cell specialization occurs by the process ofa. reproductionb. differentiationc. maturationd. growth

Answers: 2

continue

Biology, 22.06.2019 11:00, greciakawaii

2. which of the following statements does not accurately describe stem cells? a. embryonic stem cells make up the inner cell mass of a blastocyst. b. with more research, stem cells may be used to repair or replace damaged cells. c. the use of stem cells is without any objections since it can be used in therapies to humans. d. adult stem cells are multipotent and can differentiate into many types of cells.

Answers: 1

continue

Biology, 22.06.2019 16:30, rex12388

During photosynthesis, hydrogen ions are most directly used to in the chloroplast pictured above. a) make glucose b) make chlorophyll c) produce carbon dioxide d) drive the production of atp

Answers: 1

continue

Do you know the correct answer?

What is the exons and the intron in this dna strand? ATCTCTTGCCAGATAGTGTGA TACAGAACGGTCTATCACACT...