Biology
Biology, 12.03.2021 19:40, bshreve

Is it possible to determine the genotypes of a person showing a dominant phenotype? A recessive phenotype? Why?

answer
Answers: 3

Other questions on the subject: Biology

image
Biology, 22.06.2019 03:40, NANA2007
Several bird species feed in a certain species of tree. each bird species feeds in a different part of the tree. which statement is true of these bird species? a. they have adapted to different niches due to competition b. they have a carnivorous relationship with the tree species. c. they have adapted to different niches due to predation d. they have a symbiotic relationship with the tree species.
Answers: 2
image
Biology, 22.06.2019 05:30, pooch868
If a strand of dna has 35% thymine. what is the percentage of cytosine, adenine, guanine?
Answers: 3
image
Biology, 22.06.2019 08:30, abbyheule1440
Answer now! good pts and a brainliest potatoes are what im like a potatoe irdk have a good day
Answers: 2
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
Is it possible to determine the genotypes of a person showing a dominant phenotype? A recessive phe...

Questions in other subjects:

Konu
Biology, 26.03.2021 14:00