Biology
Biology, 12.03.2021 15:30, maksimgelmud7

You wish to purify an ATP-binding enzyme from a crude extract that contains several contaminating proteins. To purify the enzyme rapidly and to the highest purity, you must consider some sophisticated strategies, among them affinity chromatography. Explain how affinity chromatography can be applied to the separation, and explain the physical basis of the separation

answer
Answers: 3

Other questions on the subject: Biology

image
Biology, 21.06.2019 19:00, joho38
Which conditions are necessary for natural selection to occur? select all of the answers that apply. a. inheritable adaptations vary among individuals. b. the population size is increasing. c. more individuals are born than can survive. d. fitness varies among individuals. e. the environment changes suddenly and drastically.
Answers: 1
image
Biology, 21.06.2019 19:30, tynasiaparks13
What kind of seafood would you expect to have the highest levels of mercury and why? kelp, because they use the sun to photosynthesize on the bottom trophic level. oysters, because they filter feed on plankton on a lower trophic level. small fish, because they eat plankton on a higher trophic level. sharks, because they feed on organisms on a higher trophic level.
Answers: 1
image
Biology, 22.06.2019 09:00, anggar20
What should be the strand of complementary dna produced by the strand of dna shown below cgt ata
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
You wish to purify an ATP-binding enzyme from a crude extract that contains several contaminating pr...

Questions in other subjects:

Konu
Mathematics, 30.12.2020 05:30