1.What is a codon? What does it tell the ribosome?
2.What are amino acids?
3.How does a ribos...
Biology, 11.03.2021 22:30, SethSimunek
1.What is a codon? What does it tell the ribosome?
2.What are amino acids?
3.How does a ribosome know when a protein strand should start producing and when it should stop adding amino acids?
4.Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA
Answers: 2
Biology, 21.06.2019 21:10, dae71
Zoe decided to measure the hand length of each of her classmates. first she marked a line across each student's wrist and lined up a ruler from this mark to the top of the middle finger to measure the length. then she recorded the measurements in the table below. marla did this the same way for each classmate, and then zoe used this ruler to measure each straight line and record the data below. this data is invalid. what is the most likely reason why it is invalid? the ruler is marked in centimeters, but zoe recorded data in inches. the range of lengths is too wide, so zoe must have misread the ruler. marla’s complicated measuring procedure was overly confusing. marla could have been inconsistent while drawing outlines of fingers.
Answers: 3
Biology, 22.06.2019 04:00, zegangke1651
Will mark brainliest i only need the ! 1.use ten beads and a centromere of one color to construct the long chromosome. use ten beads and a centromere of a second color to construct the second chromosome in the long pair. make a drawing of the chromosomes in the space below. 2. for the second pair of chromosomes, use only five beads. 3. now model the replication of the chromosomes. make a drawing of your model in the space below. part b: meiosis i during meiosis i, the cell divides into two diploid daughter cells. 4. pair up the chromosomes to form tetrads. use the longer tetrad to model crossing-over. make a drawing of the tetrads in the space below. 5. line up the tetrads across the center of your “cell.” then model what happens to the chromosomes during anaphase i. 6. divide the cell into two daughter cells. use the space below to make a drawing of the result. part c: meiosis ii during meiosis ii, the daughter cells divide again. 7. line up the chromosomes at the center of the first cell, one above the other. separate the chromatids in each chromosome and move them to opposite sides of the cell. 8. repeat step 7 for the second cell. 9. divide each cell into two daughter cells. use the space below to make a drawing of the four haploid cells
Answers: 1
Biology, 22.06.2019 18:30, ryanbreland14
Crinoids, also known as sea lilies, appear to be sea plants but are not plants at all. crinoids are an echinoderm species which uses anchoring structures called holdfasts to attach themselves to the sea floor. crinoids were most abundant in pennsylvania during the mississippian period, which ranged from 375 to 320 million years ago. fossils of the crinoids shows that during most of this time pennsylvania was that provided favorable conditions for crinoid growth. a) glacial terrain b) a dry and sandy plain c) mostly mountain ranges d) covered by warm, shallow seas
Answers: 2
Mathematics, 18.09.2020 21:01
Mathematics, 18.09.2020 21:01
English, 18.09.2020 21:01
Social Studies, 18.09.2020 21:01
English, 18.09.2020 21:01
Biology, 18.09.2020 21:01
English, 18.09.2020 21:01
English, 18.09.2020 21:01
Mathematics, 18.09.2020 21:01
Mathematics, 18.09.2020 21:01