Please help me The DNA base sequence for a short gene is
TATGATACCTTGATAGCTATGTGATTG
What is the amino acid sequence of the polypeptide produced according to this DNA information? Use the genetic code chart below and your knowledge of
transcription and translation to figure out the message?

Which statements about the fluid mosaic structure of a membrane are correct? select the three correct statements. which statements about the fluid mosaic structure of a membrane are correct? select the three correct statements. the framework of a membrane is a bilayer of phospholipids with their hydrophilic heads facing the aqueous environment inside and outside of the cell and their hydrophobic tails clustered in the center. because membranes are fluid, membrane proteins and phospholipids can drift about in the membrane. the diverse proteins found in and attached to membranes perform many important functions. the kinky tails of some proteins keep the membrane fluid by preventing the component molecules from packing solidly together. membranes include a mosaic, or mix, of carbohydrates embedded in a phospholipid bilayer.

The carbon cycle is best defined as a process in which a. carbon changes from inorganic forms to organic forms and back b. carbon is changed into other elements such as oxygen or nitrogen c. carbon is continually created from the sun’s energy by plants d. carbon is consumed and regenerated from other elements such as oxygen and nitrogen

What goes in and out of a cell respiration?