A table with four organisms and their primary role in an ecosystem is shown.
Common Name
Role...
Biology, 11.03.2021 01:00, makennskyee1198
A table with four organisms and their primary role in an ecosystem is shown.
Common Name
Role in Ecosystem
Kingfisher
Carnivore
Black fly larvae
Herbivore
Trout
Carnivore
Algae
Producer
Based on the table, which trophic pyramid is correct?
Answers: 1
Biology, 21.06.2019 20:00, kiki3002
Which of the following lines of evidence would best support your assertion that a particular plant is an angiosperm? a) it produces seeds. b) it retains its fertilized egg within its archaegonium. c) it lacks gametangia. d) it undergoes alternation of generations.
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:00, gtemple22pdzs4j
What organs comprise the respiratory system of a bird
Answers: 1
Biology, 22.06.2019 14:30, angelrenee2000
The table above shows five different types of chromosomal abnormalities that can occur during meiosis. they result in either an individual having too many or too few chromosomes in their genome. what is the most likely cause of these chromosomal abnormalities?
Answers: 1
English, 26.05.2021 18:30
Business, 26.05.2021 18:30
History, 26.05.2021 18:30
Mathematics, 26.05.2021 18:30