PUNNETT SQUARE Pea plants protect their seeds in pouch-like cases called pods. Some pea plants grow inflated pods, which are smooth. Other pea plants grow constricted pods, which are bumpy. In a group of pea plants, some individuals have inflated pods and others have constricted pods. In this group, the gene for the pod shape trait has two alleles. The allele for inflated pods (D) is dominant over the allele for constricted pods (d). Complete the Punnett square below to show all possible genotypes of the offspring from a cross between two pea plants.​

What was the land like over 500 million years ago? what was under the sea?

What is the importance of having the us forest service, the bureau of land management, the us fish and wildlife service, and the national park service? to manage land resources for conservation and the development of natural resources to manage land resources for conservation and the development of urban areas to preserve historical landmarks and manage the development of urban areas to preserve historical landmarks and manage the development of rural areas

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?