Biology
Biology, 09.03.2021 01:10, jrbskso

How did scientists determine that gorillas are closely related to humans?

answer
Answers: 3

Other questions on the subject: Biology

image
Biology, 21.06.2019 18:50, Angel13613
Ectocarpene is a volatile, sperm cell-attracting material released by the eggs of the seaweed ectocarpus siliculosus. its constitution is all the double bonds are cis, and the absolute configuration of the chirality center is s. draw a stereochemically accurate representation of ectocarpene.
Answers: 3
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 15:50, quise2ross
In the diagram below, which organelle is a ribosome, which combines amino acids and produces proteins? о
Answers: 1
image
Biology, 22.06.2019 21:30, cduke1919
How would this hypothesis different from the scientific law a. increases gene flow b. eliminates fixed alleles c. allows divergence to occur d. stops adaptive radiation
Answers: 1
Do you know the correct answer?
How did scientists determine that gorillas are closely related to humans?...

Questions in other subjects: