Biology
Biology, 08.03.2021 23:50, mairealexander87

Why do objects in our solar system orbit the sun? a. because of gravitational force
b. because of their composition
c. because of their shape
d. because of their electromagnetic force

answer
Answers: 3

Other questions on the subject: Biology

image
Biology, 22.06.2019 01:30, Suphat
What are the doorways into and out of cells, attached to the membrane, and built in the rough er.
Answers: 2
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 13:00, Brooke7644
In trying to determine whether dna or protein is the genetic material, hershey and chase made use of which of the following facts? a) dna contains sulfur, whereas protein does not. b) dna contains phosphorus, whereas protein does not. c) dna contains nitrogen, whereas protein does not. d) dna contains purines, whereas protein includes pyrimidines.
Answers: 3
image
Biology, 22.06.2019 16:00, lilquongohard
Which of the following would involve looking at different structures of organisms and comparing how similar they are? a. vestigial structuresb. radiometric datingc. homologous structures
Answers: 1
Do you know the correct answer?
Why do objects in our solar system orbit the sun? a. because of gravitational force
b. becaus...

Questions in other subjects:

Konu
History, 25.01.2021 18:50
Konu
History, 25.01.2021 18:50
Konu
English, 25.01.2021 18:50