2. DNA: TITACGGCCATCAGGCAATACTGG
mRNA:
Codon:
Anitcodon:
Amino Acids:
o add speaker notes

Where do homologous chromosomes exchange genetic material through crossing over?               a.  chlorophyll    b.  centrosomes    c.  centromeres    d.  chiasma

Select all the correct answers. lactobacillus is a bacteria that live inside humans. these bacteria live on the nutrients from our bodies. they to keep our gut clean and healthy. s. typhi is a bacteria that enter our bodies through contaminated food. this bacteria causes infections in the body. based on this information, which two statements about the association between these bacteria and humans are true? a. lactobacillus shares a parasitic relationship with humans. b. s .typhi shares a parasitic relationship with humans. c. both lactobacillus and s. typhi share a parasitic relationship with humans. d. both lactobacillus and s. typhi share a mutualistic relationship with humans. e. lactobacillus shares a mutualistic relationship with humans, and s. typhi shares a parasitic relationship multiply chrse

Describe characteristics of a good respitory surface