2. DNA: TITACGGCCATCAGGCAATACTGG
mRNA:
Codon:
Anitcodon:
Amino Acids:
o add speaker notes

Which of the four major uses is predicted to change the least by 2020?

The following image is of a diatom. it lives in water and gets food from photosynthesis. it is encased in a hard shell made of something similar to glass or sand . a diatom is a(n) because it has a) multi-celled organism; specialized parts. b) vertebrate; a skeleton. c) insect; an exoskeleton. d) single-called organism; only one cell.

Which phrase is the best summary of the model shown? a. the transfer of the sun's energy through trophic levels b. a series of aerobic and anaerobic reactions c. a transformation of light energy into chemical energy d. the breakdown of food molecules