Biology
Biology, 22.02.2021 02:10, jayonelijah

Case #28104 Last month, Hudson National Bank was robbed by an unidentified man. The robber wore gloves, a hat, and a bandana that covered his face. A security guard attempting to stop the robber was knocked unconscious in a struggle. However, the guard managed to pull the hat from the robber's head. Witness accounts and security tapes led police to arrest three possible suspects. None of the suspects have alibis, but police are not certain which man is the robber. Using hair samples from the hat recovered by the security guard, the crime lab did a Southern Blot test. Hair samples were also taken from each suspect. Use the suspects' hair samples to determine the guilty party.

Part Two
Copy the DNA sequences for each suspect into a Word document.
Use your special enzyme to cut each sequence at the forward slash marks (/). (You can do this by putting spaces after each slash mark.)
Arrange the DNA cuttings in order from shortest to longest. Attach them to a special piece of nitrocellulose paper (construction paper).
Compare the probe base pair sequence with a DNA sample taken from Suspect A. Use a highlighter or different color font to mark any sequences that match the probe.
Repeat step 1 with the DNA samples for Suspects B and C.
Suspect A
TCCATCCA / TCCATCCATCCA / TCCA / GGCTTACCTATAAGG / TGGATGGATGGATGGATGGA

Suspect B
TCCATCCA / TCCATCCAATTG / TCCA / TCCATCCATCCATCCATCCA / TGGATGGATGGATGGA

Suspect C
TTAGCTA / CCGGTATGA / AGGT / CGTTATCGGATATA / GGTTAGGACCTATCGATAGA

Probe
AGGT

Questions
Answer these following questions in the essay box below.

Which suspect most likely committed the robbery?
How do you know?

answer
Answers: 3

Other questions on the subject: Biology

image
Biology, 21.06.2019 16:50, coryowens44
Which of the following would be least likely to support the modern concept of biological evolution? ( 2 points) a)different species of organisms with similar bone patterns b)different species of organisms with similar reproductive rates species in c)different domains with similar metabolic pathways species in d)different kingdoms with similar cellular structures.
Answers: 2
image
Biology, 22.06.2019 03:00, ladnerhailey16
Lola needs to sign 6 invitations. using stopwatch that measures time to tenths of a second, it takes lola 5.3 seconds to sign her full name. going by the accuracy of the stopwatch, which is the most accurate determination for the number of minutes lola needs to sign all 96 invitations
Answers: 1
image
Biology, 22.06.2019 16:00, mirianplacencia27
Lupe is a carrier for color blindness. her husband clifford is colorblind. if lupe and clifford have four children, what's the probability of a boy being colorblind?
Answers: 3
image
Biology, 22.06.2019 16:20, kdenormandie3122
What contributes to the high level of biodiversity found in wetlands? a. the large amount of available organic matter to organisms that are food for larger organisms b. the amount of available water for organism use c. the high nutrient availability d. all of the above select the best answer from the choices provided a b c d
Answers: 2
Do you know the correct answer?
Case #28104 Last month, Hudson National Bank was robbed by an unidentified man. The robber wore glo...

Questions in other subjects:

Konu
History, 25.05.2020 01:58