Answers: 3
Biology, 22.06.2019 07:20, Dallas3506
Some tools have graduations to show multiple measurements. for example, a ruler may have graduations for both millimeters and centimeters. when measuring the length of an earthworm, which graduations would allow for the most accurate measurement? millimeters centimeters decimeters meters
Answers: 2
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:00, collinpeterson21
Plz ! what does it mean for an allele to be dominant?
Answers: 1
Biology, 22.06.2019 14:00, mariana5493
What will happen if two of the base pairs of the stand of the dna are switched
Answers: 1
interpreting graphics the biodiversity hot spots shown in figure 9 share several characteristics bes...
Geography, 01.12.2020 01:10