Biology
Biology, 16.02.2021 05:40, weridness80

Where is DNA found in your cheek cells? Name two locations in the cell.

answer
Answers: 1

Other questions on the subject: Biology

image
Biology, 21.06.2019 23:00, bigboss2984
In some plants, pointed leaves (p) are dominant over rounded leaves (p). a plant with a genotype of pp
Answers: 2
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 13:00, alott1121
Select the correct answer from each drop-down menu. which phase of mitotic division is the highlighted cell undergoing? the cell is undergoing , which is the stage before .
Answers: 2
image
Biology, 22.06.2019 16:00, cabr379
Which of the following is a true statements about viruses? viruses have no nucleus. viruses are alive. viruses have a cell membrane. all viruses are deadly.
Answers: 1
Do you know the correct answer?
Where is DNA found in your cheek cells? Name two locations in the cell....

Questions in other subjects:

Konu
Mathematics, 06.09.2021 14:00