Use Diagram A and B to answer the following question
Diagram
Diagram B
Comparing Diagra...
Use Diagram A and B to answer the following question
Diagram
Diagram B
Comparing Diagram A and B, we know that Diagram Ais
RNA because it is single-stranded and contains the sugar ribose
DNA because it is double-stranded and contains the sugar ribose
DNA because it is single-stranded and contains the sugar deoxy
bose
RNA because it is double-stranded and contains the sugar deoxyribose
Answers: 2
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:50, kyleg1711
Interactions between organisms and their environment impact the organismβs overall population. the jaguar panthera onca is the largest cat in north america. it is found in areas across the southwest, including arizona, new mexico, and texas. it is a carnivore that has powerful jaws and sharp teeth and preys on fish, turtles, tapirs, and many smaller mammals. which shows the relationship between the jaguar and turtles?
Answers: 3
Biology, 22.06.2019 16:30, ingridx0
9. technology can bring both good and bad things. building a vertical farm can increase food supplies in cities (good), but it may cause unemployment in rural areas (bad). give another example of both the good and bad sides of a technological advancement (5 noints)
Answers: 1
Mathematics, 02.10.2019 15:10
History, 02.10.2019 15:10
Mathematics, 02.10.2019 15:10
Mathematics, 02.10.2019 15:10
Mathematics, 02.10.2019 15:10
Health, 02.10.2019 15:10
Physics, 02.10.2019 15:10