Biology
Biology, 12.02.2021 22:00, angellll4455

Jessica reads that microwaves, infrared waves, X-rays, and gamma rays can damage human tissue while radio waves cannot. What can Jessica conclude about the energy transferred in the waves that damage human tissue? Explain.

answer
Answers: 2

Other questions on the subject: Biology

image
Biology, 22.06.2019 00:10, haileysolis5
Which way do the nitrogenous bases in dna pair up? a. a and g; t and c b. a and c; t and g c. a and t; g and c d. a and a; t and t; g and g; c and c
Answers: 2
image
Biology, 22.06.2019 06:30, diamondgodbee123
Approximately what portion of the foods that we eat have been genetically modified in some way? a. fewer than 10% b. about 50% c. nearly 100%
Answers: 1
image
Biology, 22.06.2019 06:30, stef76
Explain how scientists use geologic time to determine the age of landforms.
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Do you know the correct answer?
Jessica reads that microwaves, infrared waves, X-rays, and gamma rays can damage human tissue while...

Questions in other subjects:

Konu
Mathematics, 02.04.2020 03:19
Konu
Mathematics, 02.04.2020 03:19
Konu
Chemistry, 02.04.2020 03:19