Select all the statements that correctly describe the differences between DNA and RNA. A RNA nucleotides contains uracil instead of thymine as in DNA.

B) DNA consists of two strands of nucleotides while RNA has one.

C) RNA consists of phosphate group while DNA has nitrogenous group.

D) DNA nucleotide comprises deoxyribose sugar while RNA consists of ribose sugar.

E) DNA nucleotides contain an adenine-uracil base pairing.

F) DNA is more complex than RNA because it has more types.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?