The diagram below shows a small portion of the amino acid sequence in a hemoglobin protein molecule. Hemoglobin is the protein found in red blood cells. The difference in
amino acid sequence in the circled
portion of the diagram below causes a
change in the shape of red blood cells.
A probable cause of this difference in
the hemoglobin molecule is
A. the inability to produce a specific enzyme, causing an accumulation of fat.
B. the substitution of one kind of nucleotide for another in a DNA molecule.
C. a recessive allele located on an X-chromosome.
D. an abnormal metabolism of phenylalanine.
LA
The
Directions: Complete all of the following for the question above.
1) GIST: (In one sentence, explain what the question is about)
(2 points)

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?