Answers: 1
Biology, 22.06.2019 02:50, mccay5016987
Keeping in mind the life cycle of bacteriophages, consider the following problem: during the reproductive cycle of a temperate bacteriophage, the viral dna inserts into the bacterial chromosome where the resultant prophage behaves much like a trojan horse. it can remain quiescent, or it can become lytic and initiate a burst of progeny viruses. several operons maintain the prophage state by interacting with a repressor that keeps the lytic cycle in check. insults (ultraviolet light, for example) to the bacterial cell lead to a partial breakdown of the repressor, which in turn causes the production of enzymes involved in the lytic cycle. as stated in this simple form, would you consider this system of regulation to be operating under positive or negative control?
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
What is thymine and its purpose...
Biology, 03.02.2020 14:04
History, 03.02.2020 14:04
Biology, 03.02.2020 14:04