DNA: GTACGCGTATACCGACATTC
mRNA:
Codon:
Anitcodon:
Amino Acids:

answer; i believe that the correct answer is ; males are hemizygous for the x chromosome;

the generally accepted parts of modern cell theory include: all known living things are made up of one or more cells. all living cells arise from pre-existing cells by division. the cell is the fundamental unit of structure and function in all living organisms.

water is a polar molecule. a chemical bond is a force of attraction between atoms or ions. bonds form when atoms share or transfer valence electrons. atoms form chemical bonds to achieve a full outer energy level, which is the most stable arrangement of electrons. so, false

explanation:

in h2o molecule, two water molecules are bonded by a hydrogen bond but the bond between two h - o bonds within a water molecule are covalent. the greater the electronegativity difference, the more ionic the bond is. bonds that are partly ionic are called polar covalent bonds. nonpolar covalent bonds, with equal sharing of the bond electrons, arise when the electronegativities of the two atoms are equal.