![answer](/tpl/images/cats/otvet.png)
Answers: 1
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
![image](/tpl/images/cats/biologiya.png)
![image](/tpl/images/cats/biologiya.png)
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 11:30, jamilamiller200
One of the newest applications of cell technology is called cybrid embryos. this process involves replacing the nuclear material of an animal cell with human nuclear material. how might this process affect public policies about research by using stem cells? the same policies and concerns about the use of human embryonic stem cells would most likely apply. the embryos would most likely be treated like traditional animal embryos and regulated accordingly. the process of forming cybrid embryos would most likely be banned by government regulators. the embryos would be treated as regular cells because they are not fully human in origin.
Answers: 2
Do you know the correct answer?
DNA: GTACGCGTATACCGACATTC
mRNA:
Codon:
Anitcodon:
Amino Acids:...
mRNA:
Codon:
Anitcodon:
Amino Acids:...
Questions in other subjects:
![Konu](/tpl/images/cats/mat.png)
Mathematics, 07.05.2021 17:10
![Konu](/tpl/images/cats/biologiya.png)
Biology, 07.05.2021 17:10
![Konu](/tpl/images/cats/himiya.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 07.05.2021 17:10
![Konu](/tpl/images/cats/mat.png)
Mathematics, 07.05.2021 17:10
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/en.png)
English, 07.05.2021 17:10
![Konu](/tpl/images/cats/en.png)
English, 07.05.2021 17:10
![Konu](/tpl/images/cats/mat.png)
Mathematics, 07.05.2021 17:10
![Konu](/tpl/images/cats/mat.png)
Mathematics, 07.05.2021 17:10