Given the following DNA strand TACGTATGCCGTATGGGCATT a) What is the DNA compliment to given strand?

b) What is the mRNA compliment to the given strand?

Simulating adaptations in a species in this activity, you will discuss in detail the adaptations in a species of rain forest plants. you will build a simulation that explains the changes in the traits of the plant population over 10 years. you will also establish a scientific explanation to justify the changes in the traits of the population, * time to complete: 1-2 hours part a an organism's adaptations are specific to its native environment. an organism that lives in a coniferous forest will have different adaptations compared to an animal that lives in a tropical rain forest. the following graphs show the temperature and precipitation throughout the year for two different forests: a coniferous forest in canada, and a tropical rain forest in belize. evaluate the graphs, and then explain why plants from these two ecosystems will have different adaptations. in your answer, explain the survival challenges that plants face in these two environments.

For each of the following, decide whether the statement describes photosynthesis, cellular respiration, or both. releases energy in the form of atp. stores energy in glucose molecules. performed by producers. performed by consumers.

Graphs you see question 5 options: the change in data over time the relationship between different dependent variables the relationship between the independent variable and the dependent variable/s the relationship between different independent variables