Biology, 18.01.2021 23:20, supersquad907p2m3vo
5. A protein shake company is testing their new protein shake on college football players.
They hypothesize that the shake will increase muscle mass by 25% in 60 days. What is
the dependent variable?
a. Muscle mass
C. diet
b. Time
d. protein shake
Answers: 2
Biology, 21.06.2019 23:00, hannahkharel2
The dna in a cell’s nucleus encodes proteins that are eventually targeted to every membrane and compartment in the cell, as well as proteins that are targeted for secretion from the cell. for example, consider these two proteins: phosphofructokinase (pfk) is an enzyme that functions in the cytoplasm during glycolysis. insulin, a protein that regulates blood sugar levels, is secreted from specialized pancreatic cells. assume that you can track the cellular locations of these two proteins from the time that translation is complete until the proteins reach their final destinations. for each protein, identify its targeting pathway: the sequence of cellular locations in which the protein is found from when translation is complete until it reaches its final (functional) destination. (note that if an organelle is listed in a pathway, the location implied is inside the organelle, not in the membrane that surrounds the organelle.)
Answers: 3
Biology, 22.06.2019 01:30, alwaysneedhelp8420
Apopulation of black bears depends on salmon from a stream for food. if a drought causes the stream to run dry one year, how will this likely impact the black bear population?
Answers: 2
Biology, 22.06.2019 06:30, DwayneLeonard618
Study the picture of the ocean. which is the best example of an organism’s niche shown in the picture? a. the environment contains several of the same species of coral. b. the shallow area of the ocean meets the needs of the coral and the fish. c. the ocean has fish and coral that live in the same area. d. the coral take in food from the water and provide shelter for the fish.
Answers: 2
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
5. A protein shake company is testing their new protein shake on college football players.
They hyp...
English, 23.10.2020 15:40
Engineering, 23.10.2020 15:40
Mathematics, 23.10.2020 15:40