Biology, 15.01.2021 20:40, juliannabartra
Which of the following changes would eliminate the energy source that generates the convection currents in the ocean?
A stopping the rotation of the earth
B Blocking off all solar radiation
C removing all salt from sea water
D eliminating producers from marine habitats
Answers: 3
Biology, 21.06.2019 22:30, maddison788
Heat from earths interior and pressure from overlying rock transform the remains of marine sediments into
Answers: 1
Biology, 22.06.2019 08:10, estebencampos69
A3 year-old is brought to the burn unit after pulling a pot of hot soup off the stove and spilling it on herself. she sustained 18% second degree burns on her legs and 20% third degree burns on her chest and arms. total body surface area burned is 38%. what icd-10-cm codes are reported for the burns (do not include external cause codes for the accident)?
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 19:20, chikooo
3. in the fruit fly, recessive mutation brown, b, causes brown color of the eye and absence of red pigment. recessive mutation p of another independent gene causes purple color of the eye and absence of brown pigment. the cross of a brown-eyed female and purple-eyed male produced wild type eyes. what will be the colors and their ratio in f2?
Answers: 2
Which of the following changes would eliminate the energy source that generates the convection curre...
Physics, 16.10.2019 08:30
Mathematics, 16.10.2019 08:30
Mathematics, 16.10.2019 08:30
Mathematics, 16.10.2019 08:30
Mathematics, 16.10.2019 08:30