Please Help!
The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is translated. Assume that the sequence is translated from left to right.
AUUUAACUGUUCUGUCUAGAG
1.
Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of amino acids, instead of just one set?
2.
Use Models Use the genetic code to translate the sequence into each of the three possible sets of amino acids.
3.
Draw Conclusions Which of the three sets of amino acids is the most likely to be included in the polypeptide? Explain your reasoning.
Answers: 3
Biology, 21.06.2019 15:50, arodriguez395
Based on the results of this study, what questions remain unanswered? how can these questions guide future research
Answers: 3
Biology, 21.06.2019 23:10, Demarcusclincy
Glucose is a form of sugar found in the blood cells use glucose as a source of energy, but too much or too little can cause serious health issues so, the body uses the hormone insulin to regulate glucose n the blood insulin maintain glucose levels in the blood if blood glucose lovels got very high, what would you expect to see happen to insulin levels?
Answers: 2
Biology, 22.06.2019 02:30, Destinywall
Did you know that a single bee would have to go to over 2 million flowers to make a single pound of honey?
Answers: 1
Please Help!
The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more...