Biology
Biology, 14.01.2021 02:00, zappygal923

There are three layers of the meninges surrounding the brain and spinal cord. List the layers in order, starting with the layer closes to the brain. -
dura mater

-
pia mater

-

answer
Answers: 2

Other questions on the subject: Biology

image
Biology, 22.06.2019 09:30, ceeejay0621
Juan and carol were studying invertebrates in biology. they knew that segmented or earth worms preferred a dark, moist habitat. during this lab, they would be investigating the responses of organisms called planaria or dugesia tigrina. these were simple flatworms that still had a one-way digestive system and a very simple nervous system. juan and carol placed the planaria in a petri dish containing cool, distilled water that was partially covered with black paper. they shined a light on the dish. next, they removed the paper and placed a small amount of chicken liver at one end of the dish. they added a few large salt crystals to the water. finally, they added drops of hot water to the cool water in the petri dish. their results can be seen in the data table. according to their experiment, all but one conclusion is valid.
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 19:20, chikooo
3. in the fruit fly, recessive mutation brown, b, causes brown color of the eye and absence of red pigment. recessive mutation p of another independent gene causes purple color of the eye and absence of brown pigment. the cross of a brown-eyed female and purple-eyed male produced wild type eyes. what will be the colors and their ratio in f2?
Answers: 2
image
Biology, 22.06.2019 20:30, Meiyuh1
Part of the elbow is formed by the end of the humerus. what do you call this part?
Answers: 1
Do you know the correct answer?
There are three layers of the meninges surrounding the brain and spinal cord. List the layers in ord...

Questions in other subjects:

Konu
Physics, 20.05.2021 23:20
Konu
Mathematics, 20.05.2021 23:20
Konu
Mathematics, 20.05.2021 23:20
Konu
Mathematics, 20.05.2021 23:20